Впг 23: Газовая колонка ВПГ-23 – Энциклопедия домовладельца

Содержание

Газовая колонка ВПГ-23 – Энциклопедия домовладельца

В названии колонок, производимых в России, часто присутствуют буквы ВПГ: это аппарат водонагревательный (В) проточный (П) газовый (Г). Цифра, стоящая после букв ВПГ, указывает на тепловую мощность аппарата в киловаттах (кВт). Например, ВПГ-23 аппарат водонагревательный проточный газовый тепловой мощностью 23 кВт. Таким образом, название современных колонок не определяет их конструкцию.

Водонагреватель ВПГ-23 был создан на базе водонагревателя ВПГ-18, выпускавшегося в Ленинграде. В дальнейшем ВПГ-23 выпускался в 90-е годы на целом ряде предприятий СССР, а затем – СИГ В эксплуатации находится некоторое количество таких аппаратов. Отдельные узлы, например, водяная часть, находит применение в некоторых моделях современных колонок Нева.

Основные технические характеристики ВПГ-23:

  • тепловая мощность – 23 кВт;
  • производительность при нагреве на 45 °С – 6 л/мин;
  • минимальное давление воды – 0,5 бар:
  • максимальное давление воды – 6 бар.

ВПГ-23 состоит из газоотвода, теплообменника, основной горелки, блок-крана и электромагнитного клапана (рис.74).

Газоотвод служит для подачи продуктов сгорания в дымоотводящий патрубок колонки. Теплообменник состоит из калорифера и огневой камеры, опоясанной змеевиком холодной воды. Высота огневой камеры ВПГ-23 меньше чем у КГИ-56, потому что горелка ВПГ обеспечивает лучшее перемешивание газа с воздухом, и газ сгорает более коротким пламенем. Значительное количество колонок ВПГ имеет теплообменник, состоящий из одного калорифера. Стенки огневой камеры в этом случае изготавливались из стального листа, змеевик отсутствовал, что позволяло экономить медь. Основная горелка – многосопловая, она состоит из 13 секций и коллектора, соединенных между собой двумя винтами. Секции собраны в единое целое с помощью стяжных болтов. В коллекторе установлены 13 сопел, каждое из которых полает газ в свою секцию.

Блок-кран состоит из газовой и водяной частей, соединенных тремя винтами (рис.75). Газовая часть блок-крана состоит из корпуса, клапана, пробки крана, крышки газового крана. В корпусе запрессован конусный вкладыш для пробки газового крана. Клапан имеет резиновое уплотнение по наружному диаметру. Сверху на него давит конусная пружина. Седло клапана безопасности выполняется в виде латунного вкладыша, запрессованного в корпус газовой части. Газовый кран имеет ручку с ограничителем, фиксирующую открытие подачи газа па запальник. Пробка крана прижимается к конусному вкладышу большой пружиной.

На пробке крана имеется выточка для подачи газа на запальник. При повороте крана из крайнего левого положения на угол в 40° выточка совпадает с отверстием для подачи газа, и газ начинает поступать на запальник. Для того, чтобы подать газ на основную горелку, на ручку крана надо нажать и повернуть дальше.

Водяная часть состоит из нижней и верхней крышек, сопла Вентури, мембраны, тарелочки со штоком, замедлителя зажигания, сальника штока и прижимной втулки штока. Вода подводится к водяной части слева, поступает в подмембранное пространство, создавая в нем давление, равное давлению воды в водопроводе. Создав давление под мембраной, вода проходит через сопло Вентури и устремляется к теплообменнику. Сопло Вентури представляет собой трубку из латуни, в самой узкой части которой выполнены четыре сквозных отверстия, которые выходят в наружную круговую выточку. Выточка совпадает со сквозными отверстиями, которые имеются в обеих крышках водяной части. По этим отверстиям давление из самой узкой части сопла Вентури передастся в надмембранное пространство. Шток тарелочки уплотняется с помощью гайки, которая сжимает сальник из фторопласта.

Работает автоматика по протоку воды следующим образом. При прохождении воды через сопло Вентури в самой узкой части наибольшая скорость движения воды и, следовательно, наименьшее давление. Это давление передается по сквозным отверстиям в надмембранную полость водяной части. В результате появляется перепад давлений под и над мембраной, которая выгибается вверх и толкает тарелочку со штоком. Шток водяной части, упираясь в шток газовой части, поднимает клапан от седла. В результате открывается проход газа на основную горелку. При прекращении протока воды давление под и над мембраной выравнивается. Конусная пружина давит на клапан и прижимает его к седлу, подача газа на основную горелку прекращается.

Электромагнитный клапан (рис.76) служит для отключения подачи газа при потухании запальника.

При нажатии на кнопку электромагнитого клапана ее шток упирается в клапан и отодвигает его от седла, сжимая при этом пружину. Одновременно якорь прижимается к сердечнику электромагнита. Газ при этом начинает поступать в газовую часть блок-крана. После розжига запальника пламя начинает обогревать термопару, конец которой устанавливается в строго определенном положении по отношению к запальнику (рис.77).

Возникшее при нагреве термопары напряжение поступает на обмотку сердечника электромагнита. При этом сердечник удерживает якорь, а с ним и клапан, в открытом положении. Время, за которое термопара вырабатывает необходимую термо-ЭДС и электромагнитный клапан начинает удерживать якорь, составляет около 60 сек. При потухании запальника термопара остывает и перестает вырабатывать напряжение. Сердечник больше не удерживает якорь, под действием пружины клапан закрывается. Подача газа и на запальник, и на основную горелку прекращается.

Автоматика по тяге отключает подачу газа на основную горелку и запальник при нарушении тяги в дымоходе, она работает по принципу «отвода газа от запальника». Автоматика по тяге состоит из тройника, который крепится к газовой части блок-крана, трубки к датчику тяги и самого датчика.

Газ из тройника подается и к запальнику, и к датчику тяги, установленному под газоотводом. Датчик тяги (рис.78) состоит из биметаллической пластины и штуцера, укрепленного с помощью двух гаек. Верхняя гайка одновременно является седлом для заглушки, перекрывающей выход газа из штуцера. К штуцеру накидной гайкой крепится трубка, подающая газ от тройника.

При нормальной тяге продукты сгорания уходят в дымоход, не нагревая биметаллическую пластину. Заглушка плотно прижата к седлу, газ из датчика не выходит. При нарушении тяги в дымоходе продукты сгорания нагревают биметаллическую пластину. Она выгибается вверх и открывает выход газа из штуцера. Подача газа на запальник резко уменьшается, пламя перестает нормально обогревать термопару. Она остывает и перестает вырабатывать напряжение. В результате электромагнитный клапан закрывается.

Ремонт и обслуживание

К основным неисправностям колонки ВПГ-23 относятся:

1. Не загорается основная горелка:

  • мало давление воды;
  • деформация или порыв мембраны – заменить мембрану;
  • засорено сопло Вентури – прочистить сопло;
  • оторвался шток от тарелочки – заменить шток с тарелочкой;
  • перекос газовой части по отношению к водяной – выровнять с помощью трех винтов;
  • шток плохо перемещается в сальнике – смазать шток и проверить затяжку гайки. Если ослабить гайку больше необходимого, возможно появление течи воды из-под сальника.

2. При прекращении водозабора основная горелка не тухнет:

  • под клапан безопасности попали загрязнения – очистить седло и клапан;
  • ослабла конусная пружина – заменить пружину;
  • шток плохо перемещается в сальнике – смазать шток и проверить затяжку гайки. При наличии пламени запальника электромагнитный клапан не удерживается в открытом положении:

3. Нарушение электрической цепи между термопарой и электромагнитом (обрыв или короткое замыкание). Возможны следующие причины:

  • отсутствие контакта между клеммами термопары и электромагнита – зачистить клеммы с помощью наждачной бумаги;
  • нарушение изоляции медного провода термопары и короткое замыкание его с трубкой – в этом случае производится замена термопары;
  • нарушение изоляции витков катушки электромагнита, замыкание их между собой или на сердечник – в этом случае производится замена клапана;
  • нарушение магнитной цепи между якорем и сердечником катушки электромагнита из-за окисления, грязи, жировой пленки и т.д. Необходимо зачистить поверхности при помощи лоскута грубой ткани. Не допускается зачистка поверхностей надфилями, наждачной бумагой и т.д.

4. Недостаточный нагрев термопары:

  • закоптился рабочий конец термопары – удалить сажу с горячего спая термопары;
  • засорились сопло запальника – прочистить сопло;
  • неверно установлена термопара относительно запальника – установить термопару относительно запальника так, чтобы обеспечить достаточный нагрев.

Запчасти для газовых колонок «Нева» 3208, ВПГ-18, ВПГ-20, ВПГ-23 АО «Ленгазаппарат» г. С. Петербург

Водяная часть ВПГ-18, ВПГ-23, НЕВА-3208 (силумин) г. Ульяновск
850517015
945 руб.

Нет в наличии

Водяная часть газовой колонки ВПГ-18, ВПГ-23, НЕВА-3208 латунь 850517002 2 299 руб.
Кабель пьезорозжига D-102. Длина 300 мм e37ec0cfd114 105 руб.

Нет в наличии

Кабель пьезорозжига D-102. Длина 400 мм. cc34e4a803eb 115 руб.

Нет в наличии

Кнопка пьезорозжига М22 х 1,5 (D-102) aeef07439a92 205 руб.

Нет в наличии

Крестовина ВПГ-23 (силумин) 7df4fa3ae688 0 руб.
Мембрана диафрагма /прокладка вакуумная/ к газовой колонке Нева, ВПГ-18, ВПГ-23, Дарина белая вакуумная 850517010 35 руб.
Мембрана диафрагма прокладка водяного блока ВПГ Нева-3110/3210/3212 черная 850517019 99 руб.
Мембрана к газовой колонке Нева белая силиконовая 08cccc3add96 105 руб.

Нет в наличии

Прокладка между деталями тройника ВПГ-18, ВПГ-23 (резина) 850517012 79 руб.
Прокладка между литой горелкой и диффузором ‘очки’ для колонки НЕВА 3208, ВПГ-18, ВПГ-23 850517011 59 руб.
Прокладка на тарелку клапана газового крана (резина) 850517022 55 руб.

Нет в наличии

Прокладка паронит (27х20х2) на газовую часть ВПГ 3fc9d79091e6 10 руб.
Прокладка паронит между газовым краном и тройником ВПГ-18, ВПГ-23 850517008 89 руб.
Ремкомплект водяной части газовой колонк ВПГ-18, ВПГ-23, Нева c914027236b0 299 руб.

Нет в наличии

Ручка ВПГ-18, ВПГ-23 универсальная ae4a49f8beea 95 руб.

Нет в наличии

Ручка ВПГ-18, Л-3 (старого образца) 697322877bad 65 руб.
Ручка ВПГ-23, НЕВА-3208 (С.Петербург) 850517026 99 руб.

Нет в наличии

Сальник (3х7 мм) для уплотнения штока водяной части ВПГ НЕВА 850512011 — 1 15 руб.
Свеча (разрядник) D 106 бпровода 850517023 149 руб.
Тарелка клапана на газовую часть ВПГ-18, ВПГ-23 (ПВХ) 40309842de53 25 руб.

Нет в наличии

Теплообменник (радиатор) для ВПГ-18, ВПГ-20, Л-3 (г. Гай) bf2a69539a47 4 705 руб.

Нет в наличии

Теплообменник газовой колонки ВПГ-23 с1977-1986г.в. 850517029 4 999 руб.
Теплообменник радиатор ВПГ НЕВА 3208 с 2006г. в., НЕВА 3010, НЕВА 3110, НЕВА 3212, НЕВА 3216, ДАРИНА 3010, ДАРИНА 3110 плоский 850517004 3 969 руб.

Нет в наличии

Теплообменник радиатор газовой колонки ВПГ-23М, НЕВА-3208 (с1986г.в.) плоский 850517003 4 499 руб.
Термопара «АРБАТ» к электромагнитному клапану газовой колонки «НЕВА» ЭМК (М8х1) L-345mm 850512014 239 руб.
Трубка медная газовой колонки ВПГ-18, Л-3 для отвода горячей воды от теплообменника 850517030 609 руб.

Нет в наличии

Трубка медная газовой колонки ВПГ-23 для подвода газа к ЭМК e59ee02efa30 185 руб.
Трубка медная газовой колонки ВПГ-23 для подвода холодной воды к водяной части 3bbea2d82560 399 руб.
Трубка медная газовой колонки НЕВА 3208, ВПГ-23 для отвода горячей воды от теплообменника №467 9d9834f6f0d3 345 руб.

Нет в наличии

Трубка медная газовой колонки НЕВА 3208, ВПГ-23 от водяной части к теплообменнику 6f8712b58081 485 руб.

Нет в наличии

Трубка медная газовой колонки НЕВА ВПГ-18, Л-3 для подвода холодной воды к водяной части de43c60164dd 245 руб.
Трубопровод запальника НЕВА — 3212,-3216 1986df662778 0 руб.

Нет в наличии

Фильтр (сетка) в ЭМК КГЭ-15М b674f798213f 55 руб.

Нет в наличии

Шток /тарелка, грибок/ в водяную часть газовой колонки Астра, КГИ, Нева, ВПГ (анодированная) 850512025-1 79 руб.
Шток /тарелка, грибок/ в водяную часть газовой колонки Астра, КГИ, Нева, ВПГ (ПВХ) a5b3d9f14116 45 руб.

Нет в наличии

Шток регулятора газа ВПГ-18, ВПГ-23 (силумин) на него одевается ручка 850517013 99 руб.
Штуцер Вентури в водяную часть ВПГ-18, ВПГ-23 (латунь) 850517035 179 руб.

Нет в наличии

Штуцер Вентури в водяную часть ВПГ-18, ВПГ-23 (ПВХ) cb971687d747 85 руб.

Нет в наличии

Инструкция по эксплуатации газовой колонки впг 23 :: glycvintdanbe

 

 

 

 

 

 

 

 

 

 

 

 

Стали, пожалуй, самыми распространенными в России и. В настоящем руководстве по эксплуатации Вы найдете ха рактеристики и.23.89 РЭ.4.1 ОПИСАНИЕ И РАБОТА ИЗДЕЛИЯ.1.1 Назначение изделия. Инструкция по эксплуатации газовой колонки впг23запрос. Обозначение аппарата: ВПГ В11 УХЛ 4.2, где.18.

НЕВА 3208 удобна, проста и надежна. Старая газовая колонка. Это аппарат с ручным поджигом. Вы приобрели газовый проточный водонагреватель с электронной системой. Думаю дело в клапане открытия газа, бывает что он не работает и отсюда вся проблема, часто ломается. В блоке водогазогорелочном из инструкции.

1 ОПИСАНИЕ И РАБОТА ИЗДЕЛИЯ.1.1 Назначение изделия. Трубка от водяной части к теплообменнику газовой колонки ВПГ 23. Подскажите пожалуйста,де можно найти инструкцию по эксплуатации,ремонту,настройке газовой колонки ВПГ .23 П Р2 ГОСТ . А что за колонка то ВПГ 23, никогда не встречал.

В настоящем руководстве по эксплуатации Вы найдете ха .23.89 15 РЭ. Запчасти к газовым колонкам ВПГ 18. Газовая колонкаВПГ 23. Современная система управления максимально облегчает эксплуатацию , при этом. Описание. Заводское название у этих моделейВПГУХЛ4.2. Номинальная тепловая мощность 23,2 кВт. Газовая колонка.

Узла водяного открывается клапан газовый 23, и замыкаются контакты. Газовые водонагревателисозданы по уникальным современным технологиям и во многом. Обозначение аппарата: ВПГ В11 УХЛ 4.2. Газовая колонкаВПГ 23. В настоящем руководстве по эксплуатации Вы найдете ха .23.89 15 РЭ.4.

С обратной стороны. Инструкция по эксплуатации газовой. Как пользоваться. Газовая колонка 16. Подключение водонагревателя к баллону со сжиженным газом. При подборе новой газовой колонки необходимо учитывать некоторые. Функциональная схема газовой колонки показана на рис.2. Газ из. Газовая колонка Нева 3208, а если точнее . ВПГ 8Инструкция.

По установке и эксплуатации газовой колонки. В настоящем руководстве по эксплуатации Вы найдете ха рактеристики и. Газовая колонкаВПГ 23. Современная система управления. Скачать газовая колонка впг 23. Газовая колонка впг 18 1 Скорость. Газовая. Установка аппарата, инструктаж владельца о принципах действия и. Колонки ВПГ.

 

Вместе с инструкция по эксплуатации газовой колонки впг 23 часто ищут

 

Газовая колонка впг 18 астра инструкция.

Львовская газовая колонка впг 18 инструкция.

Инструкция по эксплуатации газовой колонки юнкерс.

Газовая колонка electrolux инструкция.

Как включить газовую колонку junkers.

Газовая колонка аристон инструкция.

Газовая колонка нева 4510 инструкция.

Газовая колонка вайлант инструкция

 

Читайте также:

 

Ижевский котельный завод инструкция по эксплуатации

 

Ижевский котельный завод инструкция по эксплуатации

 

Ижевский котельный завод инструкция по эксплуатации

 

ВПГ втирается в доверие к Меркушкину через Чудаева? — Новости Самары и Тольятти

Автор Dobrinya На чтение 2 мин. Опубликовано

По слухам финансово-промышленная группа «Волгопромгаз» нашла способ получить расположение губернатора Самарской области Николая Меркушкина через микрорайон «Южный город». Проект компании ООО «ДК Древо», возглавляемой сыном бизнесмена Николая ЧудаеваЕвгением Чудаевым должен стать 10-ым районом Самары.

Источник фото

 

      В Самаре уже приступили к реализации крупномасштабного проекта комплексной жилой застройки «Южный город». К 2032 году в областном центре должен появиться новый район. Об этом сообщает издание «Волжская коммуна», входящее в медиа-холдинг правительства Самарской области.

      Строительные площадки располагаются в Волжском районе губернии — в 900 метрах от границы Самары. Но через несколько лет здесь фактически появится 10 район областного центра, рассчитанный на 80 тысяч жителей. Всего проект предполагает застройку на территории в 1163 га. Вчера глава региона Николай Меркушкин в сопровождении председателя совета директоров компании-подрядчика «Древо» Николая Чудаева осмотрел первые два квартала.

      Каким образом застройщику удалось получить расположение губернатора, догадаться не сложно. Компания безвозмездно передает региональным властям участок площадью 30 га под строительство агротехнопарка и 50 га в районе поселка Аглос для выделения земельных участков многодетным семьям. Как известно, Николай Меркушкин уделяет большое внимание развитию агропромышленного комплекса в губернии. С одной стороны ситуация вполне понятна. С другой стороны, семейство Чудаевых может иметь здесь скрытые мотивы. Достаточно вспомнить, как в марте текущего года Евгений Чудаев выносил проект «Южного города» на обсуждение Общественного совета самарской городской Думы. Тогда Евгений Чудаев заверил членов ОС, что его проект будет относиться к Волжскому району. По слухам, у бизнесмена сложились договоренности с Волгопромгазом, и возглавляемый аффилированным холдингу Александром Адамовым Волжский район служил своеобразным прикрытием для Чудаевых. Видимо, бизнесмены не были до конца уверены, что смогут реализовать своей проект на территории Самары. Теперь же, когда семейству Чудаевых удалось найти общий язык с Меркушкиным, о прописке Волжского района никто даже не упоминает. Между тем, «Южный город» может стать уже вторым проектом, где интересы холдинга ВПГ совпали с интересами руководства областного правительства. Первым проектом является Дворец единоборств

Похожее

COSMO SYSTEM VPG-23 КОНТРОЛЛЕР VME BUS CARD

COSMO SYSTEM VPG-23 КОНТРОЛЛЕР VME BUS CARD

В наличии: 2 шт.

Гарантия: 90 дней

ЮИ Глобальная Технологическая Компания. ООО основана в 1987 году,

основные продукты, которые мы продаем?

◆Распределенная система управления (РСУ)

◆Программируемый логический контроллер (ПЛК)

◆Удаленный модуль ввода/вывода (RTU) \ SWITCH

◆Промышленный ПК (IPC)\сервер\Промышленная материнская плата

◆Промышленный низкочастотный экран\Вакуумный насос\ИБП\ДАТЧИК

◆Жесткие диски малой емкости для промышленного использования SCSI (50,68,80Pin)

◆AnyBus (шлюз)\Сервопривод контроллера робота \ Серводвигатель \
  Человеко-машинный интерфейс ЧМИ \ Контроллер автоматизации

Инвертор \ Частота \ Преобразователь \ Источник питания \ РЕЛЕ \ РОБОТ

◆Вспомогательные продукты, связанные с промышленным контролем

Из-за быстрых изменений в технологических продуктах и ​​бума рынка.

Учитывая рыночный спрос, мы построили системы хранения продуктов автоматизации на рынке Тайваня, поэтому мы можем быстро отремонтировать запасные части в соответствии с потребностями клиента.

НАШ СЕРВИС

◆Три месяца гарантии

◆На складе: Доставка в течение 24 часов после оплаты (кроме праздничных дней)

◆Фьючерсы:Срок поставки от 7 до 14 дней

◆У нас есть различные бренды и модели.

ПОЛИТИКА ВОЗВРАТА

◆Для состояния товара, не как описано, дефект.Пожалуйста, сообщите нам о замене или возврате денег в течение 90 дней с момента получения.

◆Возврат должен быть в исходном состоянии и включать все поставляемые аксессуары.

◆ Все товары будут поставляться с нашей гарантийной этикеткой. Если какие-либо наклейки были удалены или подделаны, ваш возврат будет отменен.

Пожалуйста, свяжитесь с нами по любым дополнительным вопросам о покупке.

ТЕЛ.: +886-7-3752385;+886-7-3752386

Электронная почта: [email protected]
WeChat ID: yuyiplc
электронная почта: [email protected]


(Б/У ПРОВЕРЕНО ОЧИСТКА)


COSMO SYSTEM VPG-23 CVDP-004 ПЛАТА НЭП-16Т

COSMO SYSTEM VPG-23 CVDP-004 NEP-16T BOARD

В наличии: 2 шт.

Гарантия: 90 дней

ЮИ Глобальная Технологическая Компания. ООО основана в 1987 году,

основные продукты, которые мы продаем?

◆Распределенная система управления (РСУ)

◆Программируемый логический контроллер (ПЛК)

◆Удаленный модуль ввода/вывода (RTU) \ SWITCH

◆Промышленный ПК (IPC)\сервер\Промышленная материнская плата

◆Промышленный низкочастотный экран\Вакуумный насос\ИБП\ДАТЧИК

◆Жесткие диски малой емкости для промышленного использования SCSI (50,68,80Pin)

◆AnyBus (шлюз)\Сервопривод контроллера робота \ Серводвигатель \
  Человеко-машинный интерфейс ЧМИ \ Контроллер автоматизации

Инвертор \ Частота \ Преобразователь \ Источник питания \ РЕЛЕ \ РОБОТ

◆Вспомогательные продукты, связанные с промышленным контролем

Из-за быстрых изменений в технологических продуктах и ​​бума рынка.

Учитывая рыночный спрос, мы построили системы хранения продуктов автоматизации на рынке Тайваня, поэтому мы можем быстро отремонтировать запасные части в соответствии с потребностями клиента.

НАШ СЕРВИС

◆Три месяца гарантии

◆На складе: Доставка в течение 24 часов после оплаты (кроме праздничных дней)

◆Фьючерсы:Срок поставки от 7 до 14 дней

◆У нас есть различные бренды и модели.

ПОЛИТИКА ВОЗВРАТА

◆Для состояния товара, не как описано, дефект.Пожалуйста, сообщите нам о замене или возврате денег в течение 90 дней с момента получения.

◆Возврат должен быть в исходном состоянии и включать все поставляемые аксессуары.

◆ Все товары будут поставляться с нашей гарантийной этикеткой. Если какие-либо наклейки были удалены или подделаны, ваш возврат будет отменен.

Пожалуйста, свяжитесь с нами по любым дополнительным вопросам о покупке.

ТЕЛ.: +886-7-3752385;+886-7-3752386

Электронная почта: [email protected]
WeChat ID: yuyiplc
электронная почта: [email protected]


(Б/У ПРОВЕРЕНО ОЧИСТКА)


COSMO SYSTEM VPG-23 КОНТРОЛЛЕР VME BUS CARD VPG-23 Поставщик на TradeAsia

Характеристики :

КАРТА ШИНЫ VME КОНТРОЛЛЕРА COSMO SYSTEM VPG-23

Спецификация :

КАРТА ШИНЫ VME КОНТРОЛЛЕРА COSMO SYSTEM VPG-23

Другое 1 :

COSMO SYSTEM VPG-23 КОНТРОЛЛЕР VME BUS CARD

Гарантия: Три месяца

О нас

Профиль компании YU-YI Technology Co,.Ltd, основанная в 1987 году нашей эры, на сегодняшний день имеет опыт 28 лет. Основными продуктами, которые мы продаем, являются распределенная система управления (РСУ) Программируемый логический контроллер (ПЛК) модуль удаленного ввода/вывода (RTU) Промышленный ПК (IPC) промышленный низкочастотный экран жесткие диски малой емкости для промышленного использования SCSI (50,68,80Pin) AnyBus (Шлюз) человеко-машинный интерфейс? сопутствующие товары, связанные с промышленным контролем Из-за быстрых изменений в технологических продуктах и ​​бума рынка.Принимая во внимание рыночный спрос, мы построили системы хранения продуктов автоматизации на рынке Тайваня, поэтому мы можем быстро ремонтировать запасные части в соответствии с потребностями клиента. ФЛЭШ-ДИСК:IDE,SCSI (50,68 Pin:Размер:3,5,2,5″): ABB MOD300 Тейлор АЛЛЕН БРЭДЛИ Серия 61XX Система Bailey Net90 и INFI90 Фишер перемонтирует Provx Система ввода/вывода FOXBORO Ханивелл TDC2000/3000 Система управления Leeds & Northrup MAX Система Мура Апакс Сименс PCS7/COROS/TELEPERM XP Система Westinghouse WDPF YOKOGAWA CENTUM/XL

Тип бизнеса: нет

Основная продукция

Yokogawa, Yaskawa, Keyence, Reliance, Omron, Mitsubishi, Emerson, Fisher, Rosemount, Foxboro, Bailey, Honeywell, FANUC, GE, Eaton Electrical, CT и т. Д. Более 20 000 видов продукции, продаваемой по всему миру!!!

Контактная информация

Y0089100K000BP23R by VPG Foil Resistors Резисторы со сквозными отверстиями

Всегда активны

Строго необходимые файлы cookie

Эти файлы cookie необходимы для работы веб-сайта и не могут быть отключены в наших системах.Обычно они устанавливаются только в ответ на ваши действия, которые представляют собой запрос на услуги, такие как установка параметров конфиденциальности, вход в систему или заполнение форм. Вы можете настроить свой браузер так, чтобы он блокировал эти файлы cookie или уведомлял вас о них, но в этом случае некоторые части сайта могут не работать.

 

Используемые файлы cookie

ARRAffinity

Этот файл cookie используется для привязки клиента к экземпляру веб-приложения Azure, используемому чат-ботом Ask Avnet.

avnBusinessCategory

Этот файл cookie создается для определения региона/скоростной лодки учетной записи терминов, в которую вошел пользователь. идентификатор магазина.

avnetCookieAcceptance

Этот файл cookie предназначен для отслеживания того, приняли ли вы политику использования файлов cookie. Это будут случайные символы, чтобы создать для вас уникальный идентификатор. Этот идентификатор будет храниться в базе данных на сервере, принадлежащем Avnet, и будет использоваться для фильтрации файлов cookie, которые вы разрешили/запретили.

AVN_AskAvnetRole

Этот файл cookie используется для определения того, включен ли для пользователя чат-бот Ask Avnet.

AVN_Cart_[Regioncd]_[StoreId]

Этот файл cookie содержит номер активного заказа для пользователя.

AVN_CompanyName

Этот файл cookie содержит значение названия компании пользователя.

AVN_Currency_Selected

Этот файл cookie содержит значение отображаемой валюты магазина.

AVN_Has_Order

Этот файл cookie используется для определения наличия у пользователя активной корзины.

AVN_Intro_Guide

Этот файл cookie используется для определения отображения руководства по обновлению инвентаря.

AVN_IpAddress

Файл cookie содержит IP-адрес пользователя.

AVN_MBRGRP

Этот файл cookie создается, чтобы указать, является ли зарегистрированный пользователь академическим пользователем (классификация регионов Японии).

AVN_NavBannerOFF

Этот файл cookie определяет, показывать ли пользователю баннер заголовка после его закрытия.

AVN_OpenQuote_[StoreId]_[ActiveOrgEntityId]_[UserId]

Этот файл cookie используется для определения наличия у пользователя открытой заявки.

avn_show_pomanager

Этот файл cookie определяет отображение меню загрузки PO для пользователя.

Avn_TaxExempt

Этот файл cookie используется для определения того, имеет ли пользователь статус освобожденного от уплаты налогов.

Avn_TaxExempt_Override

Этот файл cookie используется для определения того, имеет ли пользователь статус переопределения освобождения от уплаты налогов.

AVN_TermsAccountCurrency

Этот файл cookie содержит валюту транзакции пользователя.

AVN_WCSInfo

Этот файл cookie содержит данные профиля пользователя.

guestBomDetails

Этот файл cookie содержит идентификатор BOM гостевого пользователя.

da_sid

Содержит уникальный идентификатор сеанса (или посещения).

DA_LID

содержит уникальный идентификатор посетителя

BM_SZ

, необходимый для Akamai Telemetry

com.ibm.wps.state.preprocessors.locale.languageCoo

Это cookie содержит значение выбранный пользователем язык.

chatId

Этот файл cookie содержит уникальный идентификатор чата Ask Avnet для пользователя.

cookieconsent_status

Этот файл cookie используется для отслеживания и анализа работы сайта.

cookie_enable

Этот файл cookie используется для определения того, включил ли пользователь файлы cookie в своем браузере.

expires_in

Этот файл cookie содержит значение срока действия токена Ask Avnet Chat Bot.

introContent

Этот файл cookie содержит текст приветствия Ask Avnet.

JSESSIONID

Этот файл cookie используется для управления сеансом.

LtpaToken2

Этот файл cookie содержит значение токена LTPA WebSphere Application Server, используемого для единого входа.

ohDontShowPopUp

Этот файл cookie используется для определения отображения всплывающего окна предупреждения на странице истории заказов.

PD-H-SESSION-ID

Файлы cookie Webseal для приложений *.avnet.com

PD-H-SESSION-ID-TST

Файлы cookie Webseal для приложений *.avnet.com

3

-ID

Файл cookie Webseal для таких приложений, как Iquote, edgekey.avnet.com и т. д.Приложения avnet.com

PD-S-SESSION-ID-PCI

Файлы cookie webseal, созданные для приложений *.avnet.com

PHPSESSID

Файлы cookie, созданные приложениями на языке PHP. Это идентификатор общего назначения, используемый для поддержки переменных сеанса пользователя. Обычно это сгенерированное случайным образом число, способ его использования зависит от конкретного сайта, но хорошим примером является сохранение статуса входа пользователя в систему между страницами.

PunchoutCookie

Этот файл cookie создается для идентификации пользовательского сеанса Punchout MIT.

selectedSpeedBoat

Этот файл cookie содержит значение выбранного Speed ​​Boat.

Спикер

Этот файл cookie используется для отслеживания и анализа работы сайта.

StoreID

Этот файл cookie содержит код региона и языка.

S_CC

S_CC

Этот файл cookie установлен и прочитан код JavaScript, чтобы определить, включено если посетитель новый или возвращающийся

s_sq

Этот файл cookie устанавливается и считывается кодом JavaScript, когда включены функции Click Map и Activity Map; он содержит информацию о предыдущей ссылке, по которой щелкнул пользователь

s_vi

Уникальный идентификатор посетителя, отметка времени/даты

TLTSID

Этот файл cookie используется для объединения пользовательских сеансов для функции воспроизведения Tealeaf

2

токен

Этот файл cookie содержит токен, сгенерированный для разговора с чат-ботом Ask Avnet.

User_Country

Этот файл cookie содержит значение страны пользователя на основе географического местоположения.

WCMStore

Этот файл cookie содержит идентификатор организации пользователя.

WC_ACTIVEPOINTER

Этот файл cookie содержит значение идентификатора хранилища сеанса. Это значение используется для выбора хранилища для запуска команды, если оно не указано в URL-адресе.

WC_AUTHENTICATION_[Идентификатор пользователя]

WebSphere Commerce использует безопасный файл cookie аутентификации для управления данными аутентификации.Файл cookie аутентификации передается только через SSL. Для повышения безопасности он имеет временную метку с подписью. Этот файл cookie используется для аутентификации пользователя через SSL-соединения.

WC_CartTotal_[Идентификатор корзины]

Этот файл cookie содержит такие значения, как промежуточная сумма товаров в заказе (до учета налогов и доставки), количество товаров, язык, валюта.

WC_DeleteCartCookie_[Store_Id]

Файл cookie для принудительного обновления других файлов cookie мини-корзины.

WC_ECCNFormSubmit_[Номер формы]

Этот файл cookie предназначен для определения того, заполнил ли пользователь форму ECCN.

WC_GENERIC_ACTIVITYDATA

Этот файл cookie существует, только если это сеанс общего пользователя (-1002). Этот файл cookie хранит значения сеанса, такие как идентификатор магазина, идентификатор языка и контракты.

WC_LoginSuccessOmniture_[Store Id]

Этот файл cookie используется для захвата события успешного входа в систему и отправки статуса в Omniture

WC_PERSISTENT

Этот файл cookie используется для сохранения идентификатора пользователя, языка включено) и валюта для каждого идентификатора магазина, посещенного в сеансе.Если пользователь посещает более 1 магазина, может существовать несколько наборов идентификаторов.

WC_RegistrationSuccessKenshoo_

Этот файл cookie используется для отслеживания и анализа производительности сайта.

WC_RegistrationSuccessOmniture_

Этот файл cookie создается аналитическим пакетом Websphere, чтобы определить, была ли попытка регистрации успешной или нет.

WC_SESSION_ESTABLISHED

Этот файл cookie создается при первом запросе, обрабатываемом средой выполнения WebSphere Commerce.Например, запрос без кеша.

WC_timeoffset

Этот файл cookie используется для отслеживания и анализа производительности сайта.

WC_USERACTIVITY_[UserID]

Этот файл cookie представляет собой файл cookie сеанса пользователя, который передается между браузером и сервером как через соединение SSL, так и без него. Он используется для идентификации пользователя через соединения без SSL. Он содержит значения сеанса пользователя, такие как время входа в сеанс, и информацию об идентификаторе сеанса, такую ​​как идентификатор пользователя и идентификатор хранилища.

wfx_unq

Этот файл cookie устанавливается со случайным значением, генерируемым каждый раз, когда Whatfix загружается на страницу, в качестве уникального идентификатора пользователя. Он не хранит никакой личной информации и автоматически истекает через 3 месяца.

_abck

Требуется для телеметрии Akamai

__cfduid

Файл cookie __cfduid устанавливается сервисом CloudFlare брандмауэра веб-приложений (WAF) Whatfix для идентификации доверенного веб-трафика.’IOkڈ i6[_ mӺPLTB6aNM4jkM`MWR1+j:VҴ¦èo0piA L28im-h5> H;i6Ma&AAIh0b{M5AMmSb7MZi1I[B0r#&䓂aM>-Yaa&Ixa(b0Ib»»»»»!»»&D a4! ȃL 09һB»»»#B»»»»»» $k/y [email protected]]TaTRPT»& «?Zb)6FL% ̲*Q

Идентификация белка, связанного с геномом астровируса человека (VPg), необходимого для инфекционности вируса

Abstract

Белки, связанные с геномом вируса (VPgs), были идентифицированы в нескольких семействах одноцепочечных вирусов с положительной смысловой РНК. Присутствие такого белка в семействе Astroviridae не было полностью выяснено, хотя предполагаемая кодирующая область VPg в открытой рамке считывания 1a (ORF1a) астровируса с высоким сходством аминокислотной последовательности с кодирующей областью VPg Caliciviridae была обнаружена. выявлено ранее.В этой работе мы представляем несколько экспериментальных данных, которые показывают, что РНК астровируса человека (HAstV) кодирует VPg, необходимый для вирусной инфекционности: (i) обработка РНКазой РНК, очищенной от клеток, инфицированных астровирусом, приводит к одному белку 13–15 кДа, совместимому с предсказанным размером VPg астровируса; (ii) антитело, используемое для обнаружения этого белка массой от 13 до 15 кДа, специфически направлено против области, которая включает предполагаемую кодирующую область VPg; (iii) обнаруженный белок массой от 13 до 15 кДа был частично секвенирован, и полученная последовательность содержится в предсказанном вычислением VPg; (iv) белок, полученный из этой предполагаемой кодирующей области VPg, представляет собой сильно неупорядоченный белок, напоминающий VPg собемо-, калици- и потивирусов; (v) протеолитическая обработка геномной РНК приводит к потере инфекционности; и (vi) мутагенез Tyr-693, включенный в предполагаемый белок VPg, является летальным для репликации HAstV, что сильно подтверждает его функциональную роль в ковалентной связи с вирусной РНК.

ВВЕДЕНИЕ

Белки, связанные с вирусным геномом (VPgs), представляют собой малые белки, кодируемые вирусом, которые ковалентно связаны с 5′-концом многих вирусных геномов РНК посредством фосфодиэфирной связи. С момента открытия такого белка в геноме полиовируса сообщалось, что несколько вирусов животных и растений несут белки, ковалентно связанные с их геномами (45). Среди вирусов с геномами одноцепочечной РНК положительного смысла (+ssRNA) VPgs были описаны для вирусов животных (семейства Picornaviridae , Caliciviridae и Dicistroviridae ), вирусов растений ( Comoviridae , Potyviridae ). и семейства Luteoviridae и рода Sobemovirus ), а также грибковых вирусов ( семейства Barnaviridae ) (36, 45).Во время жизненного цикла этих вирусов VPg выполняет множество функций, играя роль в ключевых процессах, таких как репликация генома, синтез вирусного белка и, возможно, инкапсуляция генома (12, 26).

Общей чертой VPgs является то, что они богаты основными аминокислотами [в основном Lys (K), Gly (G), Thr (T) и Arg (R)], что способствует взаимодействию с отрицательно заряженной РНК ( 30). Для ковалентного связывания VPg с РНК пикорнавирусы используют гидроксильную группу консервативного остатка Tyr, расположенного вблизи N-конца VPg.Poty- и калицивирусы также используют остаток Tyr, тогда как комовирусы, как сообщается, используют остаток Ser (45). В случае собемовирусов остаток для связывания РНК не является консервативным внутри рода и, по-видимому, видоспецифичен (37). Другой общей чертой VPgs является их внутреннее расстройство. Недавно сообщалось, что VPgs некоторых собемовирусов и потивирусов являются «нативно развернутыми белками» (14, 21, 47), лишенными как вторичной, так и третичной структур и существующими в физиологических условиях в виде динамического ансамбля конформаций.Используя компьютерные прогнозы, неупорядоченные домены были описаны в VPgs нескольких калицивирусов, таких как вирус геморрагической болезни кроликов, вирус везикулярной экзантемы свиней, вирус Саппоро, манчестерский вирус и вирус Норуолк (21). Было постулировано, что это свойство является одним из факторов, обеспечивающих функциональное разнообразие VPgs (21).

Астровирусы человека (HAstV) признаны распространенными вирусными патогенами, вызывающими гастроэнтерит у детей (33). Астровирусы представляют собой безоболочечные +оцРНК-вирусы, принадлежащие к семейству Astroviridae , которое включает вирусы как млекопитающих, так и птиц.Геном HAstV имеет длину 6,8 т.п.н., полиаденилирован и содержит три перекрывающиеся открытые рамки считывания (ORF) и две нетранслируемые области. Неструктурные белки (nsPs), к которым относятся вирусная протеаза и РНК-зависимая РНК-полимераза (RdRp), синтезируются в виде полипротеинов из ORF1a и ORF1b соответственно с использованием геномной РНК в качестве матрицы, тогда как структурные белки экспрессируются из субгеномная РНК, образующаяся после репликации и содержащая ORF2 (33). Отсутствие участка, кодирующего метилтрансферазу, и сходство RdRp астровируса с другими полимеразами супергруппы I Кунина (к которой относятся VPg-содержащие вирусы, такие как пикорнавирусы, калицивирусы и некоторые растительные вирусы) позволяют предположить, что геном HAstV, а также как субгеномная РНК, может быть связана с белком VPg на его 5′-конце (1, 27, 29).В соответствии с этой идеей, обработка РНК HAstV протеиназой К препятствует восстановлению инфекционных вирусов после трансфекции РНК дикого типа (50). Основываясь на сравнении последовательностей астровирусов человека и животных с некоторыми членами семейств Caliciviridae , Picornaviridae и Potyviridae , предполагаемая кодирующая область VPg была картирована ниже протеазного мотива, частично совпадающего с сигналом ядерной локализации. NLS), а Tyr-693 в консервативном TEEEY-подобном мотиве постулируется как остаток, ответственный за ковалентную связь с вирусной РНК (1, 29).Более того, в последовательностях астровирусов также можно идентифицировать два консервативных аминокислотных мотива, характерных для N-конца калицивируса VPg [KGK(N/T)K и (D/E)EY] (1, 8). Что касается границ этого предполагаемого VPg, Al-Mutairy et al. (1) предположил потенциальный N-концевой сайт протеолитического расщепления [Q(K/A)], расположенный вверх по течению, либо непосредственно рядом, либо на расстоянии 1-2 аминокислотных остатков от мотива KGK(N/T) K и C-концевой сайт протеолитического расщепления [Q(P/A/S/L)] между 92 и 143 аминокислотными остатками ниже N-концевого сайта расщепления.Хотя наличие VPg в геноме HAstV предполагалось в течение многих лет (27) и многие наблюдения предполагают, что HAstV может кодировать белок VPg, его присутствие еще не доказано экспериментально. Основная цель нашего исследования состояла в том, чтобы идентифицировать и охарактеризовать белок, связанный с геномом HAstV.

МАТЕРИАЛЫ И МЕТОДЫ

Клетки и вирусы.

Клеточная линия аденокарциномы толстой кишки человека CaCo2 была выращена в минимальной основной среде Игла (MEM) с добавлением 10% фетальной телячьей сыворотки (FBS) и использовалась для размножения адаптированного к клеточной культуре штамма HAstV серотипа 4 (HAstV-4) в качестве а также для восстановления мутантных вирусов.Клетки CaCo2 инфицировали, как описано ранее (38), с некоторыми модификациями. Вкратце, клеточные монослои дважды промывали фосфатно-солевым буфером (PBS) и инокулировали вирусными штаммами, предварительно обработанными 10 мкг/мл трипсина (GIX, Sigma), в течение 30 мин при 37°C. После 1-часовой адсорбции при 37°C добавляли МЕМ-оболочку с добавлением 5 мкг/мл трипсина (для выделения вируса) или 2% FBS (для иммунофлуоресцентного анализа). Клетки почек детенышей хомячка (BHK-21) и клетки гепатоцеллюлярной карциномы человека (Huh7.5.1) выращивали в MEM с добавлением 10% FBS и использовали для трансфекции РНК HAstV.

Обнаружение связанных с геномом белков в препаратах РНК HAstV.

Инфицированные или ложно инфицированные клетки CaCo2, выращенные в колбах 25 см 2 , обрабатывали трипсином через 24 часа после инфицирования и осаждали при 3000 × г в течение 10 мин. После промывания PBS РНК из осажденных клеток экстрагировали с помощью минипрепарата GenElute Mammalian Total RNA (Sigma) и расщепляли 100 ЕД РНКазы I (Ambion) в течение 1 ч при 37°C.Полученные препараты разделяли с помощью SDS-PAGE и подвергали блоттингу. Белки электрофоретически переносили на нитроцеллюлозные мембраны и после блокирования 5% буфером обезжиренного молока-TBS [50 мМ Tris-HCl (pH 7,6) и 100 мМ NaCl] зондировали мембраны антиядерной адресной областью (анти-NAR). сыворотка, любезно предоставленная М. Дж. Картером из Школы биомедицинских и молекулярных наук Университета Суррея, Соединенное Королевство (52), которая распознает область около 30% С-конца полипротеина nsP1a (остатки с 643 по 940 штамма А2). /88 Newcastle, соответствующий области, охватывающей протеазный мотив и конец ORF1a).Детекцию проводили с использованием антикроличьего антитела, конъюгированного с пероксидазой хрена, и ферментативную реакцию проводили с помощью набора SuperSignal West Femto (Pierce).

Идентификация белков методом масс-спектрометрии.

Зараженные клетки CaCo2 (из 10 175-см колб 2 ) обрабатывали трипсином через 24 ч после инфицирования и осаждали при 3000 × г в течение 10 мин. После промывания PBS РНК из осажденных клеток экстрагировали с использованием набора RNAqueous Midiprep (Ambion).Элюированную РНК (1 мл) осаждали хлоридом лития и ресуспендировали в конечном объеме 50 мкл перед обработкой РНКазой I (Ambion) 1000 ЕД в течение 1 ч при 37°C. Полученный препарат разделяли с помощью SDS-PAGE. Затем гель окрашивали нитратом серебра (AgNO 3 ), полосу интересующего белка вырезали и расщепляли в геле трипсином (модифицированный для секвенирования, Promega) в автоматическом роботе Investigator ProGest (Genomic Solutions). Затем триптические пептиды экстрагировали из гелевой матрицы 10% муравьиной кислотой и ацетонитрилом, сушили в скоростном вакууме и анализировали с помощью жидкостной хроматографии в режиме реального времени – ионизации наноэлектрораспылением – тандемной масс-спектрометрии (Cap-LC-nano-ESI-Q-TOF). (CapLC, Micromass-Waters) на Протеомической платформе Научного парка Барселоны Университета Барселоны (член сети ProteoRed).Данные были сгенерированы в формате файла PKL и отправлены для поиска в базе данных на сервере MASCOT.

Прогноз беспорядка.

Предсказания фолдинга проводились с помощью двух программных пакетов: нейросетевого предсказателя PONDR VL-XT (44) и FoldIndex (bioportal.weizmann.ac.il/fldbin/findex.) (39), которые предсказывают, в какой степени заданная последовательность белков внутренне развернута. Анализы проводились с использованием значений по умолчанию.

Анализ протеолитического расщепления РНК HAstV в зависимости от вирусной инфекционности.

Тотальную РНК из инфицированных HAstV клеток CaCo2 использовали для трансфекции клеток BHK-21. Перед трансфекцией очищенную РНК подвергали протеолитическому расщеплению 400 мкг/мл протеиназы К (ПК) (Sigma) в течение 1 ч при 55°С в 10 мМ Трис-HCl (рН 8), 1 мМ ЭДТА и 0,5% натрия. додецилсульфат (ДСН). В качестве контроля эквивалентные количества РНК также обрабатывали, как описано выше, но без ПК. После расщепления обработанные ПК и необработанные РНК осаждали этанолом и количественно определяли с помощью спектрофотометрии и одноэтапной количественной ПЦР с обратной транскрипцией в реальном времени (qRT-PCR), направленной на консервативную область ORF1b HAstV, как описано ранее (46).Целевой участок генома HAstV размером 91 п.н., включенный в плазмиду pGEM, использовали для построения стандартной кривой для количественного определения молекул РНК астровируса. За день до трансфекции клетки высевали на покровные стекла, предварительно обработанные поли-1-лизином (Sigma), в 6-луночные планшеты так, чтобы в день трансфекции клетки были приблизительно на 60% конфлюэнтны. Клетки трансфицировали с использованием реагента для трансфекции FuGENE HD (Roche) в соответствии с инструкциями производителя с некоторыми изменениями. Вкратце, смесь для трансфекции готовили путем разбавления 5 мкг РНК в 100 мкл среды с уменьшенной сывороткой Opti-MEM I (Invitrogen) и добавления 10 мкл реагента для трансфекции FuGENE HD.После 25-минутной инкубации при комнатной температуре смесь добавляли к клеткам, предварительно дважды промытым PBS, и выдерживали в 2 мл среды с уменьшенной сывороткой Opti-MEM I. Каждый эксперимент по трансфекции включал отрицательный контроль, в котором клетки имитировали трансфекцию в отсутствие РНК. Доказательства репликации астровируса контролировали путем обнаружения вирусных белков с помощью иммунофлуоресценции через 24 часа после трансфекции и вирусной РНК с помощью ОТ-ПЦР через 12 и 24 часа после трансфекции (см. ниже).

Конструирование мутантов VPg.

Для введения мутаций в кодирующую область VPg в качестве исходного материала использовали инфекционный клон pAVIC, любезно предоставленный С. Мацуи (Стэнфордский университет) (11). Эта плазмида содержит полноразмерную кДНК оксфордского штамма HAstV-1, из которой можно получить инфекционную РНК с использованием РНК-полимеразы Т7 и аналога кэпа. Фрагмент BglII-XbaI pAVIC (положения с 1657 по 3156), содержащий предполагаемую кодирующую область VPg, встраивали в вектор pCITE-2a. Мутации вводили в кодирующую VPg последовательность в плазмиде pCITE-2a посредством сайт-направленного мутагенеза с использованием протокола мутагенеза QuikChange (Stratagene) и олигонуклеотидов, показанных на рис.Предполагаемые мутанты подвергали скринингу с помощью анализа последовательности, и мутантные фрагменты BglII-XbaI повторно вставляли в плазмиду pAVIC. Полноразмерные кДНК мутантного HAstV и HAstV дикого типа получали из соответствующих плазмид с помощью ПЦР с использованием набора Expand Long Range dNTPack (Roche). Праймеры, использованные в ПЦР, были модифицированы на 5′-конце, чтобы содержать последовательность промотора Т7, и на 3′-конце, чтобы содержать 43-мерный поли(Т)-хвост. ДНК, амплифицированные T7-dT, затем использовали в качестве матриц для реакций транскрипции in vitro с системой транскрипции mMessage mMachine (Ambion) для получения транскриптов дикого типа и модифицированных кэпированных транскриптов, содержащих сконструированные мутации, т.е.д., Y693A, Y693S, Y720A, Y723A, Y728A, Y729A, Y747A и L701I. После обработки транскрипционной смеси ДНКазой РНК очищали путем осаждения хлоридом лития, определяли количество с помощью спектрофотометрии и анализировали на агарозных гелях.

Таблица 1

Олигонуклеотиды, используемые для строительства мутантов VPG с использованием протокола мутагенеза VPG (Stratagene)

7 GGTCTGGCTACCCTGACGCTGATGATGAAGATTACTATG CATAGTAATCTTCATCATCAGCGTCAGGGTAGCCAGACC
Sense 5′-3 ‘Sequence
+ + CTTCTTACTGAGGAAGAGGCTCGAGAACTCTTAGAGAAAGG
Y693A CCTTTCTCTAAGAGTTCTCGAGCCTCTTCCTCAGTAAGAAG
Y720A + GGTGAGAGGTCTGGCGCCCCTGACTATGATGATG
Y720A CATCATCATAGTCAGGGGCGCCAGACCTCTCACC
Y723A +
Y723A —
Y728A + С CCTGACTATGATGATGAAGATGCCTATGATGAAGATGATGATGG
Y728A CCATCATCATCTTCATCATAGGCATCTTCATCATCATAGTCAGGG
Y729A + GATGATGAAGATTACGCTGATGAAGATGATGATGGCTGGGG
Y729A CCCCAGCCATCATCATCTTCATCAGCGTAATCTTCATCATC
Y747A + GGGGAATGGTTGGTGATGATGTAGAATTTGATGCTACTGAAGTG
Y747A CACTTCAGTAGCATCAAATTCTACATCATCACCAACCATTCCCC
L701I + CGAGAACTCTTAGAGAAAGGTATAGACCGTGAGACATTCC
L701I GGAATGTCTCACGGTCTATACCTTTCTCTAAGAGTTCTCG
Y693S + CTTCTTACTGAGGAAGAGTCTCGAGAACTCTTAGAGAAAGG 9067 7
Y693S CCTTTCTCTAAGAGTTCTCGAGACTCTTCCTCAGTAAGAAG

Анализ мутаций VPg в отношении вирусных реагентов и спасение вирусных реагентов.

Транскрипты дикого типа и модифицированные кэпированные транскрипты, содержащие сконструированные мутации, т.е. Y693A, Y693S, Y720A, Y723A, Y728A, Y729A, Y747A и L701I, использовали для трансфекции клеток BHK-21 и Huh7.5.1, по существу, как описано выше. . В обоих случаях репликацию астровируса контролировали путем обнаружения вирусных белков с помощью иммунофлуоресценции через 24 часа после трансфекции. Для восстановления мутантных вирусов клетки Huh7.5.1 инкубировали в течение дополнительных 48 часов в присутствии 5 мкг/мл трипсина, после чего подвергали 3 циклам замораживания/оттаивания и центрифугировали при 3000 × g для удаления клеточного дебриса.Затем лизаты ложно- и РНК-трансфицированных клеток Huh7.5.1 использовали для последовательного пассирования на клетках CaCo2, предварительно обработанных 10 мкг/мл трипсина, в течение 30 мин при 37°C. Репликацию астровирусов в инфицированных клетках CaCo2 оценивали с помощью иммунофлуоресценции, а извлеченные вирусы исследовали с помощью ОТ-ПЦР и анализа последовательности с использованием реакционного набора ABI Prism BigDye Terminator Cycle Sequencing Ready (Applied Biosystems).

Иммунофлуоресценция.

Клетки дважды промывали PBS и фиксировали 3% параформальдегидом в PBS в течение 20 мин при комнатной температуре.Пермеабилизацию проводили в течение 10 мин при комнатной температуре с помощью 0,5% Triton X-100 в 20 мМ глицин-PBS. После промывки клетки блокировали в течение 1 ч при комнатной температуре в 20 мМ глицин-PBS, содержащем 10% FBS. Клетки инкубировали в течение ночи при 4°C с разведением 1:10 000 моноклонального антитела (MAb) 8E7 (любезно предоставленного P. Sanders из R-Biopharm AG), которое распознает структурные белки астровирусов (23). Антимышиное антитело, конъюгированное с индокарбоцианином-3, использовали в качестве вторичного антитела в разведении 1:5000.После иммунофлуоресцентного мечения клетки окрашивали 1 мкг/мл DAPI (4′,6′-диамидино-2-фенилиндол) в течение 15 мин при комнатной температуре. Монтаж проводили в Mowiol, и клетки визуализировали под флуоресцентным микроскопом (Olympus BX61). Процент трансфицированных клеток, экспрессирующих вирусные белки, оценивали путем подсчета количества положительных клеток и общего количества клеток из 4 разных полей на образец.

Обнаружение РНК HAstV с помощью традиционной ОТ-ПЦР.

Влияние протеолитической обработки вирусной РНК ФК на репликацию вируса в трансфицированных клетках BHK-21 оценивали с помощью ОТ-ПЦР.РНК HAstV выявляли с помощью описанных ранее праймеров А1 и А2 (18, 51), которые амплифицируют фрагмент ORF1a, используя прямой праймер А1 в реакции ОТ с целью выявления преимущественно антигеномной РНК. Амплифицированные продукты анализировали на 1,5% агарозном геле и выявляли окрашиванием бромистым этидием.

РЕЗУЛЬТАТЫ

Идентификация и секвенирование вирусного белка, ковалентно связанного с РНК HAstV.

Для анализа наличия белка VPg, связанного с геномом HAstV, тотальную РНК (вместе с ковалентно связанными с ней белками) выделяли из инфицированных HAstV-4 или ложно инфицированных клеток CaCo2 и обрабатывали РНКазой I.Анализ обработанных образцов методом Вестерн-блоттинга с анти-NAR сывороткой, которая направлена ​​против С-конца полипротеина nsP1a, содержащего предполагаемую кодирующую область VPg, выявил белок, соочищенный с РНК, с расчетной молекулярной массой в диапазоне от 13 до 15 кДа, что очень близко к ожидаемой молекулярной массе продукта, полученного из кодирующей области VPg, предложенной Al-Mutairyet et al. (11 кДа) (1) (). Полосы не были обнаружены в образцах, выделенных из ложно инфицированных клеток с расщеплением РНКазой или без него, или в образцах, выделенных из инфицированных клеток без обработки РНКазой, где белки, связанные с РНК, оставались наверху разделяющего геля.При анализе тотальных клеточных экстрактов вместо очищенных образцов РНК два основных белка ∼32 и ∼17 кДа реагировали с антителом против NAR, а также белок с высокой молекулярной массой (), что согласуется с данными, представленными ранее (52). Остается неясным, соответствует ли белок ∼17 кДа, обнаруженный в клеточных экстрактах, белку-предшественнику белка 13–15 кДа, связанному с РНК, или белку с другим паттерном посттрансляционных модификаций.

Идентификация вирусного белка, ковалентно связанного с РНК HAstV.(A) Вестерн-блоттинг (WB) анализ экстрактов клеток CaCo2, инфицированных HAstV-4, и белков, которые были совместно очищены с РНК, выделенной из ложно инфицированных и инфицированных клеток через 24 часа после заражения и окрашены антисывороткой против NAR. РНК-соочищенные белки анализировали до и после обработки РНКазой I. (В) Протеолитическое расщепление РНК-ассоциированного белка оценивали путем инкубации с протеиназой К (ПК). Образцы РНК, очищенные от инфицированных клеток, сначала имитировали или обрабатывали РНКазой I, а затем инкубировали с ФК или без нее.Полное переваривание белка молекулярной массой от 13 до 15 кДа подтверждали методом WB с использованием антитела против NAR. (C) Восприимчивость белка VPg к расщеплению PK до обработки РНКазой I. Образцы, обработанные сначала ФК, а затем РНКазой I, анализировали с помощью WB с антителом против NAR. Положения маркеров молекулярного размера в килодальтонах (кДа) указаны слева на каждой панели. Небольшие различия в характере подвижности между белком VPg после обработки РНКазой на панелях A, B и C можно объяснить неустойчивой электрофоретической подвижностью неупорядоченных белков и/или эффективностью обработки РНКазой.

Чувствительность белка с молекулярной массой от 13 до 15 кДа к протеолитическому расщеплению анализировали путем обработки вирусной РНК, очищенной от инфицированных клеток, ФК. Образцы РНК, извлеченные из инфицированных клеток, обрабатывали РНКазой I, как описано выше, а затем обрабатывали ПК, что приводило к полной деградации белка молекулярной массой 13–15 кДа (13). В контроле, не обработанном РНКазой I, белковых полос обнаружено не было, так как недеградированная РНК не попадает в гель. Однако при расщеплении РК перед обработкой РНКазой I был обнаружен частично расщепленный белок массой 12 кДа (12).Это частичное расщепление белка с молекулярной массой 13–15 кДа можно объяснить определенной степенью защиты белка от протеолиза за счет его ковалентной связи с РНК.

Чтобы подтвердить идентичность белка с молекулярной массой 13–15 кДа как предсказанного VPg, полосу белка вырезали из окрашенного серебром геля () и анализировали с помощью комбинированной жидкостной хроматографии и тандемной масс-спектрометрии с предшествующей обработкой трипсином. Также была обнаружена дополнительная полоса 27 кДа, соответствующая РНКазе I, используемой для расщепления РНК.Секвенирование белка массой от 13 до 15 кДа позволило идентифицировать пептид длиной 15 аминокислот (аминокислоты с 699 по 713 полипротеина nsP1a, т. е. KGLDRETFLDLIDRI), что составляет 16% от предсказанной полноразмерной последовательности VPg. (). Хотя нам не удалось получить полную последовательность с точными границами VPg, молекулярная масса обнаруженного белка согласуется с сайтами расщепления, предсказанными Al-Mutairy et al. (1).

Окрашивание серебром HAstV VPg и идентификация белка с помощью масс-спектрометрии.(A) Суммарная РНК (и связанные с ней белки), выделенная из культур клеток CaCo2, инфицированных HAstV-4, через 24 ч после заражения была проанализирована с помощью SDS-PAGE и окрашивания серебром после обработки РНКазой I. (B) 13-к Белковую полосу 15 кДа вырезали и обрабатывали трипсином для идентификации белка с помощью Cap-LC-nano-ESI-Q-TOF. Идентифицированный 15-членный пептид выделен жирным шрифтом по всей длине предсказанной аминокислотной последовательности HAstV VPg.

Предполагается, что VPg астровируса является внутренне неупорядоченным белком (IDP).

VPgs нескольких вирусов были описаны как внутренне неупорядоченные белки (14, 21, 47). Учитывая эту общую черту, мы приступили к компьютерному анализу степени беспорядка предсказанного астровируса VPg. Полноразмерные полипротеины HAstV-4 (инвентарный номер GenBank {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AY720891″,»term_id»:»57545930″,»term_text»:» AY720891″}}AY720891) были подвергнуты прогнозированию нарушений с помощью программного обеспечения FoldIndex (39). Как показано на , предсказание ясно показывает, что предполагаемый VPg, расположенный между аминокислотами 665 и 755 полипротеина nsP1a HAstV, находится в развернутой области полипротеина, в отличие от других астровирусных белков.Аналогичные результаты были получены с предиктором PONDR, и результаты не изменились, когда последовательность VPg была проанализирована изолированно (данные не показаны). За исключением структурного полипротеина, для которого было предсказано, что N-концевая и С-концевая области являются развернутыми областями (данные не показаны), последовательность VPg была единственной относительно большой областью в геноме HAstV с высокой оценкой беспорядка. Интересно, что эта особенность сохранилась среди всех других астровирусов млекопитающих и птиц, которые были полностью секвенированы (данные не показаны).

Прогнозируемое нарушение полипротеина nsP1a HAstV. (A) Схематическое представление организации генома HAstV и полипротеина nsP1a (увеличенный фрагмент). Указаны предсказанные трансмембранные спирали (TM), протеазный мотив (PRO), предсказанный геликазный домен (HEL), спирально-спиральные структуры (CC), предсказанный белок, связанный с геномом (VPg) и гипервариабельная область (HVR). Стрелки указывают на предполагаемые идентифицированные сайты протеолитического расщепления (33). (B) Прогноз FoldIndex для полипротеина nsP1a HAstV, содержащего предсказанный домен VPg между аминокислотами 665 и 755.

Белок VPg необходим для инфекционности вирусной РНК.

Тотальную РНК, выделенную из клеток CaCo2, инфицированных HAstV-4, использовали для трансфекции клеток BHK-21 после обработки с ФК или без нее. Репликацию HAstV в трансфицированных клетках анализировали с помощью иммунофлуоресценции с использованием 8E7 MAb, направленного против структурных белков астровирусов, и путем обнаружения вирусной реплицирующейся РНК с помощью обычной ОТ-ПЦР. В то время как в отсутствие ФК-обработки примерно 5% трансфицированных клеток экспрессировали вирусные структурные белки, ФК-обработка полностью устраняла вирусную экспрессию (2), что свидетельствует о том, что ковалентная связь VPg с вирусным геномом играет ключевую роль в инфекционности.Протеолитическая обработка вирусной РНК также приводила к отмене транскрипции вирусной РНК, поскольку РНК астровируса (преимущественно реплицирующая РНК отрицательного смысла) выявлялась с помощью ОТ-ПЦР с использованием прямого праймера в реакции ОТ только в клетках, трансфицированных РНК-необработанной РНК ( ). Тем не менее, из этих экспериментов нельзя предположить прямую роль VPg в вирусной транскрипции, поскольку потеря репликации РНК может быть связана с прекращением экспрессии вирусных белков, включая неструктурные белки, участвующие в синтезе вирусной РНК.

Влияние протеолитического расщепления на инфекционность РНК HAstV. РНК, выделенная из инфицированных HAstV клеток CaCo2, обработанных или необработанных протеиназой K (PK), использовали для трансфекции клеток BHK-21. Вирусную репликацию анализировали путем обнаружения вирусных структурных белков с помощью иммунофлуоресцентного анализа через 24 часа после трансфекции с использованием 8E7 MAb (увеличение, × 100), (A) и репликации вирусной РНК с помощью ОТ-ПЦР через 12 часов и 24 часа после трансфекции (B). РНК, выделенные из инфицированных клеток CaCo2 через 12 и 24 ч после заражения, использовали в качестве положительных контролей ОТ-ПЦР.Положения маркеров молекулярного размера в парах оснований (п.н.) указаны слева на соответствующей панели.

В качестве контроля перед трансфекцией очищенная РНК HAstV была количественно определена с помощью qRT-PCR, чтобы гарантировать трансфекцию с равным количеством копий генома. Отсутствие различий в титрах копий генома РНК HAstV-4 в отсутствие и в присутствии ПК [(5,318 ± 0,22) × 10 9 и (4,953 ± 0,18) × 10 9 копий РНК HAstV-4/мкг РНК, соответственно].

Мутагенез Tyr-693 в белке VPg является летальным для репликации HAstV.

Был проведен мутационный анализ области VPg HAstV, чтобы определить, является ли Tyr-693, предполагаемый остаток, участвующий в ковалентной связи с вирусной РНК (1, 29), существенным для функции белка. Предполагаемый VPg HAstV содержит, помимо Tyr-693, пять остатков Tyr в положениях 720, 723, 728, 729 и 747, которые потенциально могут связывать VPg с вирусной РНК (положения пронумерованы в соответствии с инвентарным номером GenBank). «:»entrez-нуклеотид»,»attrs»:{«текст»:»L23513″,»term_id»:»3550941″,»term_text»:»L23513″}}L23513).При сравнении последовательностей HAstV с последовательностями других астровирусов и калицивирусов видно, что единственным остатком Tyr, который на 100% консервативен среди всех изолятов, включая астровирусы млекопитающих и птиц, а также калицивирусы, является Tyr-693, который содержится в (D/E)EY мотив (). Tyr-723 и Tyr-747 также высококонсервативны, но некоторые штаммы астровирусов и калицивирусов обнаруживают полуконсервативные замены остатков Trp или Phe. Наконец, в то время как Tyr-720 проявляет сильную консервативность только среди астровирусов млекопитающих, Tyr-728 и Tyr-729 проявляют незначительную степень консервативности.Все эти остатки Tyr мутировали в Ala с использованием инфекционного клона HAstV-1. Мутация Leu-701 в Ile использовалась в качестве контрольной мутации. Кэпированные транскрипты, полученные из плазмид дикого типа и мутантных плазмид, сначала использовали для трансфекции клеток BHK-21, а репликацию астровируса контролировали с помощью иммунофлуоресценции с использованием 8E7 MAb. Клетки, экспрессирующие капсидные белки астровируса, были обнаружены в клетках, трансфицированных конструкциями Y720A, Y723A, Y728A, Y729A и Y747A, а также конструкциями дикого типа и контроля (L701I) ().Трансфекция мутантом Y693A не показала положительных клеток с помощью иммунофлуоресценции, что свидетельствует о том, что Tyr-693 необходим для репликации вируса. Ни в одном случае не было обнаружено, что ложнотрансфицированные клетки экспрессируют структурные белки астровируса (данные не показаны).

Множественное выравнивание последовательностей астровируса (AstV) и калицивируса (CV) в области, предсказанной для астровируса VPg. Выравнивание последовательностей проводили с помощью инструмента ClustalW2 (31). В анализ были включены следующие репрезентативные штаммы (инвентарные номера GenBank указаны в скобках): штамм астровируса человека типа 1 Oxford (HAstV-1) ({«type»:»entrez-нуклеотид»,»attrs»:{«text» :»L23513″,»term_id»:»3550941″,»term_text»:»L23513″}}L23513), штамм астровируса человека 4 типа Дрезден (HAstV-4) ({«type»:»entrez-нуклеотид»,»attrs «:{«text»:»AY720891″,»term_id»:»57545930″,»term_text»:»AY720891″}}AY720891), астровирус человека MLB-1 (MLB-1) ({«type»:»entrez- нуклеотид»,»attrs»:{«text»:»FJ222451″,»term_id»:»209552865″,»term_text»:»FJ222451″}}FJ222451), бычий астровирус B76/HK (BAstV) ({«type»: «entrez-нуклеотид»,»attrs»:{«text»:»HQ916316″,»term_id»:»331691522″,»term_text»:»HQ916316″}}HQ916316), свиной астровирус 5 штамм 33/США (PAstV) ( {«type»:»entrez-нуклеотид»,»attrs»:{«text»:»JF713711″,»term_id»:»354682131″,»term_text»:»JF713711″}}JF713711), астровирус человека VA-1 ( VA-1) ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»NC_013060″,»term_id»:»255357299″,»term_t ext»:»NC_013060″}}NC_013060), астровирус овец (OAstV) ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»NC_002469″,»term_id»:»9635572″,» term_text»:»NC_002469″}}NC_002469), астровирус норки (MAstV) ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»AY179509″,»term_id»:»28628261″,» term_text»:»AY179509″}}AY179509), астровирус индейки 2 (TAstV-2) ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»NC_005790″,»term_id»:»45239034 «,»term_text»:»NC_005790″}}NC_005790), утиный астровирус 1 штамм DA93 (DAstV) ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»FJ919228″,»term_id» :»284157374″,»term_text»:»FJ919228″}}FJ919228) и куриный астровирус (CAstV) ({«type»:»entrez-нуклеотид»,»attrs»:{«text»:»NC_003790″,»term_id «:»20514394″,»term_text»:»NC_003790″}}NC_003790) для AstVs и вируса Norwalk (HuCV/NV) ({«type»:»entrez-protein»,»attrs»:{«text»:»NP_786948 «,»term_id»:»28416962″,»term_text»:»NP_786948″}}NP_786948), вирус Лордсдейла (HuCV/Lordsdale) ({«type»:»entrez-нуклеотид»,»attrs»:{«текст»: «X86557″,»term_id»:»100895 2″,»term_text»:»X86557″}}X86557), калицивирус кошек (FCV) ({«type»:»entrez-protein»,»attrs»:{«text»:»NP_783307″,»term_id»:» 28268485″,»term_text»:»NP_783307″}}NP_783307), и вирус геморрагической болезни кроликов (RHDV) ({«type»:»entrez-protein»,»attrs»:{«text»:»NP_740330″,»term_id «:»25121578″,»term_text»:»NP_740330″}}NP_740330) для резюме.Полная и высокоскоростная идентичность аминокислот (включая консервативные и полуконсервативные замены) визуализируется серой штриховкой. Пробелы обозначены черточками. Сохранившиеся мотивы KGK(N/T)K и (D/E)EY отмечены прямоугольниками. Шесть остатков Tyr в положениях 693, 720, 723, 728, 729 и 747 (пронумерованные в соответствии с эталонным штаммом HAstV-1 Oxford [{«type»:»entrez-нуклеотид»,»attrs»:{«текст»: «L23513», «term_id»: «3550941», «term_text»: «L23513»}}L23513]), которые были изменены на Ala, обозначены стрелками.Tyr в положении 693 также был заменен на Ser, а мутация Leu-701 на Ile использовалась в качестве контрольной мутации.

Влияние точечных мутаций VPg на репликацию вируса. Иммунофлуоресцентный анализ репликации астровируса на клетках BHK-21, трансфицированных кэпированными транскриптами, полученными из плазмиды дикого типа (Wt) (pAVIC) или соответствующих плазмид, содержащих сконструированные мутации в кодирующей области VPg (панель 1: Y693A; панель 2: Y720A). ; панель 3: Y723A; панель 4: Y728A; панель 5: Y729A; панель 6: Y747A; панель 7: L701I; панель 8: Y693S; панель 9: Wt).Детекцию астровирусных структурных белков на трансфицированных клетках BHK-21 проводили через 24 часа после трансфекции с использованием 8E7 MAb. Увеличение, ×200.

Поскольку эффективность системы обратной генетики, описанной с использованием клеток BHK-21, низкая (11), метод, описанный Velázquez-Moctezuma et al. с использованием клеток Huh7.5.1 (50) использовали для спасения инфекционных вирусов. Иммунофлуоресцентный анализ также использовали для мониторинга репликации вируса в клетках Huh7.5.1 после трансфекции, и результаты были аналогичны результатам, полученным с клетками BHK-21 (данные не показаны).Вирионы, извлеченные из трансфицированных клеток Huh7.5.1, амплифицировали последующими пассажами в клетках CaCo2. Опять же, только мутанты HAstV Y720A, Y723A, Y728A, Y729A и Y747A, а также конструкции дикого типа и контрольные конструкции (L701I) могли быть сохранены и дополнительно пассированы в клетках CaCo2, но мутация Y693A была летальной. Спасенные вирусы были проанализированы с помощью ОТ-ПЦР, и анализ последовательности подтвердил наличие сконструированной мутации в геноме РНК. Интересно отметить, что мутанты Y728A, Y729A и L701 были восстановлены до высоких титров во время ранних пассажей, не показывая отличий от вируса дикого типа, в то время как мутанты Y720A, Y723A и ​​Y747A, которые содержат мутации в остатках Tyr, которые более консервативны (), их труднее восстановить до высоких титров (данные не показаны).

Кроме того, было также исследовано, может ли замена Tyr-693 на Ser с его доступной гидроксильной группой вызвать инфекционные вирусы, но эта мутация также была летальной, и экспрессия структурного белка не была обнаружена с помощью иммунофлуоресценции в исходной трансфекции () или в последующих пассажах на клетках CaCo2.

ОБСУЖДЕНИЕ

Хотя наличие белка, связанного с геномом вируса, в HAstV и его геномная локализация предполагалось и предполагалось несколькими авторами в прошлом (1, 27, 29, 50), его существование еще не было экспериментально продемонстрировано. .В текущем исследовании мы обсуждаем несколько экспериментальных данных, подтверждающих наличие такого белка в геноме HAstV. Анализ белков, совместно очищенных с РНК астровируса методом вестерн-блоттинга с антителом против С-концевой области астровируса nsP1a, содержащей предполагаемую область VPg, выявил белок с молекулярной массой 13-15 кДа. Прямое секвенирование этого белка подтвердило, что он содержит не менее 16% центральной части предсказанного расчетным путем VPg (1). Хотя полная аминокислотная последовательность белка не была получена из-за технических ограничений, т.е.е., получая большое количество такого небольшого белка, молекулярная масса обнаруженной полосы была очень близка к ожидаемой для предсказанного VPg (1), что составляет 11 кДа. Кроме того, антисыворотка анти-1a 778–792 , направленная против синтетического пептида (с 778 по 792 остаток), содержащегося в гипервариабельной области (HVR) nsP1a (16), не реагировала с 13–15 -kDa (данные не показаны), что согласуется с предсказанным C-концевым сайтом расщепления, опубликованным Al-Mutairy et al.(1) в остатке Q 755 .

Геномная локализация ВПг астровируса (протеаза-ВПг-полимераза) аналогична локализации ВПг собемовирусоподобной супергруппы (собемо-, лютео- и барнавирусы) и отличается от локализации ВПг пикорнавирусоподобной супергруппы (пикорна-, калици-, поти-, комо- и дицистровирусы), в которых кодирующая область VPg расположена выше вирусного протеазного мотива (45). HAstV VPg расположен ниже протеазного мотива, близко к 3′-концу ORF1a, и включен в С-концевой белок nsP1a (16).Данные с использованием анти-1a 778–792 антител против области HVR показали, что С-концевой белок nsP1a накапливается в перинуклеарной области в ассоциации с эндоплазматическим ретикулумом и вирусной РНК (16). Происходит ли эта колокализация с вирусной РНК до или после протеолитического расщепления, которое высвобождает белок VPg, до сих пор неизвестно и нуждается в дальнейшем изучении. Однако из-за высокого содержания гидрофильных аминокислот в VPg вполне вероятно, что С-концевой белок nsP1a или даже более крупный белок может функционировать как гидрофобный предшественник, направляя VPg к клеточным мембранам до протеолитического расщепления, необходимого для высвобождения зрелого VPg. , подобно тому, что происходит с полиовирусом, в котором предшественник 3AB представляет собой гидрофобный белок, связанный с мембраной, который действует как донор VPg в мембранных комплексах репликации для синтеза РНК (41).

Белок VPg, обнаруженный в гелях SDS-PAGE, имеет молекулярную массу несколько выше ожидаемой (13–15 кДа против 11 кДа), и это может быть связано с несколькими причинами. Поскольку очищенные белки расщепляются РНКазой перед электрофорезом, небольшое увеличение молекулярной массы может быть связано с небольшим количеством остаточных нуклеотидов, связанных с белком. В качестве альтернативы это также может быть связано с посттрансляционными модификациями белка, такими как фосфорилирование. Фактически, С-концевой белок nsP1a, экспрессируемый в клетках насекомых, модифицируется посттрансляционно путем фосфорилирования (10), и, хотя фосфорилированные остатки специально не идентифицированы, некоторые из потенциальных сайтов фосфорилирования расположены в пределах предполагаемой области VPg, особенно Tyr в положениях 693, 728, 729 и 747 (17).Действительно, фосфорилирование было описано как посттрансляционная модификация собемо- и потивирусных VPgs (37, 40). Более того, С-концевой белок nsP1a взаимодействует сам с собой с образованием олигомеров и с вирусным RdRp (10). Интересно, что домены олигомеризации и полимеразного взаимодействия картируются между остатками 744 и 777 и остатками 655 и 743 полипротеина nsP1a (10) соответственно, которые частично в первом случае и почти полностью во втором случае лежат в предполагаемой области VPg (аминокислоты 665-755).Эти потенциальные множественные способности связывания астровируса VPg также были описаны для белков VPg или их предшественников в других вирусах, таких как полиовирус и потивирус (9, 12, 26, 41, 53), и могут быть связаны с его неупорядоченной структурой. Используя компьютерные прогнозы, мы обнаружили, что HAstV VPg, как собемо-, поти- и калицивирусные VPg (14, 21, 47), является IDP. Большая пластичность неупорядоченных белков будет сочетать высокую специфичность с низкой аффинностью, чтобы обеспечить более высокие скорости ассоциации и диссоциации, сделать возможным временное связывание многочисленных структурно различных мишеней, обеспечить способность преодолевать стерические ограничения и облегчать участие во многих биологических процессах, таких как клетки. контроль цикла, транскрипционная и трансляционная регуляция, слияние мембран и транспорт, а также передача сигнала (48).Поскольку многие вирусы демонстрируют ограниченный размер генома, они полагаются на многофункциональность своих белков и, как было показано, содержат наибольшую долю белков с консервативными предсказанными неупорядоченными областями по сравнению с археями, бактериями и эукариотами (5). Интересно, что внутреннее нарушение, как было показано, важно для фосфорилирования белков, и предполагается, что фосфорилирование происходит преимущественно в областях IDP (24). Хорошо известно, что в качестве обратимых модификаций фосфорилирование регулирует многие процессы жизненных циклов +ssRNA вируса, включая репликацию (25).Фосфорилирование IDPs, по-видимому, важно для их структурной и функциональной регуляции, т.к. как переходы от беспорядка к порядку, так и от порядка к беспорядку, как наблюдалось, следуют за событием фосфорилирования (28), при этом конформационные изменения часто влияют на функцию белка. На основании этих соображений можно предположить, что регуляция функции VPg зависит от статуса его фосфорилирования.

Белки VPg других +ssRNA вирусов связаны как с инициацией трансляции вирусного генома, так и с процессами репликации РНК с примированием белка (12, 26).В случае калицивирусов удаление VPg путем протеолитической обработки РНК резко снижает как инфекционность (15, 22), так и трансляцию РНК in vitro (22), что указывает на роль в экспрессии вирусного белка. Аналогичные наблюдения были описаны для других вирусов, таких как непо- и собемовирусы (20, 49). Дополнительными доказательствами участия калицивирусного VPg в инициации трансляции являются взаимодействия между VPg и eIF3, а также eIF4E и eIF4GI (4, 6, 7, 13).Помимо роли в трансляции, калицивирусный VPg может действовать как праймер во время репликации вирусной РНК, поскольку было показано, что он может быть нуклеотидилирован вирусным RdRp или его предшественником (2, 19, 32) и что RdRp может синтезировать VPg. -примированная РНК in vitro (43). Напротив, в случае пикорнавирусов ясно, что VPg играет роль в инициации репликации РНК, в то время как он необязателен для трансляции. Участие VPg в вирусной транскрипции подробно описано для полиовируса, в котором считается, что уридилированная форма VPg, продуцируемая 3D pol , играет роль в праймировании синтеза как отрицательной, так и положительной цепи (41).Поскольку трансляция генома пикорнавируса зависит от внутреннего сайта посадки рибосомы (IRES), протеолитическая обработка РНК не приводит к потере инфекционности и не влияет на ее трансляционную способность in vitro (41). Представленные здесь данные показывают, что фармакокинетическая обработка РНК HAstV полностью устраняет инфекционность, что измеряется как синтезом вирусного белка с помощью иммунофлуоресценции, так и продукцией молекул вирусной РНК в трансфицированных клетках, и это подчеркивает сильное сходство со стратегией калицивируса, где VPg необходим для генома. перевод.Следовательно, размер и аминокислотная последовательность HAstV VPg больше похожи на калицивирусные VPg, чем на пикорнавирусные VPg, которые представляют собой относительно меньшие белки (приблизительно от 2 до 6 кДа). Если бы HAstV VPg не требовался для трансляции молекул геномной РНК, высвобождаемых в цитоплазме после проникновения в клетку, трансфекция РНК, обработанных PK, привела бы как к экспрессии вирусных белков, так и к репликации вируса. Хотя другие наблюдения, такие как потребность в аналоге кэпа на 5′-конце РНК, транскрибированных in vitro , для их инфекционности после трансфекции и отсутствие идентификации последовательности IRES в геноме HAstV, также поддерживают гипотезу о том, что HAstV VPg могут взаимодействовать с клеточным механизмом для инициации трансляции, для подтверждения этой идеи необходимо провести дополнительные исследования трансляции геномной РНК in vitro .

Поскольку ранее было показано, что астровирус RdRp взаимодействует с доменом белка nsP1a, который почти полностью соответствует VPg (10), мы можем предположить, что астровирус VPg подвергается нуклеотидилированию и также играет роль в транскрипции вируса, аналогично тому, что происходит в полиовирусы, калицивирусы и другие вирусы, содержащие ВПг. Хотя необходимо провести дальнейшие исследования, чтобы определить конкретную роль астровируса VPg в репликации вируса, наши результаты ясно показывают, что его функция зависит от Tyr-693, который сохраняется среди всех изученных на сегодняшний день астровирусов человека и животных.Как показано для полиовируса (42), потивируса (35), калицивируса (34) и комовируса (3), мутация остатка Tyr или Ser, ответственного за связь с РНК, или изменение его положения в VPg приводит к летальному фенотипу. . В настоящем исследовании мы демонстрируем, что мутагенез Tyr-693 в Ala и даже его замена на Ser, который также обеспечивает гидроксильную группу, является летальным для репликации астровирусов, что убедительно подтверждает функциональную роль этого остатка в формировании ковалентной связи с вирусная РНК.Поскольку трансфекция клеток кэпированными мутантными транскриптами Y693A и Y693S не приводит к образованию инфекционных вирусов, наша гипотеза состоит в том, что VPg может быть необходим для инициации синтеза всех типов вирусных РНК, продуцируемых в клетках во время инфекции. В этих экспериментальных условиях исходные кэпированные транскрипты будут транслироваться при проникновении в клетку, но белки VPg, синтезированные с мутированным остатком Tyr-693, не смогут участвовать в синтезе возникающих РНК. Наконец, наши результаты также показывают, что остатки Tyr в положениях 720, 723 и 747, хотя и не являются критическими для инфекционности вируса, также могут быть важны для эффективности репликации.Характеристика белка HAstV VPg не только даст представление о цикле репликации этого человеческого патогена, но также поможет идентифицировать новые уникальные противовирусные мишени.

VPG для участия в конференциях инвесторов в сентябре

МАЛВЕРН, Пенсильвания, 17 августа 2021 г. (GLOBE NEWSWIRE) — Vishay Precision Group, Inc. (NYSE: VPG), ведущий производитель прецизионных датчиков и сенсорных систем, объявила, что компания примет участие в следующих предстоящие конференции виртуальных инвесторов:

  • Colliers 2021 Institutional Investor Conference в четверг, 9 сентября 2021 г.; VPG будет участвовать только в виртуальных встречах на этой конференции.
  • Конференция инвесторов Sidoti Fall Smallcap, среда, 22 сентября 2021 г. чтобы запланировать личную встречу с руководством, обратитесь к координаторам корпоративного доступа на соответствующих конференциях или напишите Стиву Кантору в отдел по связям с инвесторами VPG по адресу [email protected]ком.

    Для получения дополнительной информации об этих мероприятиях или других мероприятиях VPG по связям с инвесторами посетите веб-сайт http://ir.vpgsensors.com.

    О VPG
    Vishay Precision Group, Inc. является всемирно признанным разработчиком, производителем и продавцом компонентов, основанных на технологии резистивной фольги; датчики; и системы измерения на основе датчиков, специализирующиеся на растущих рынках измерения напряжения, силы, веса, давления и тока. VPG является лидером на рынке продуктов с технологией фольги, предлагая постоянные технологические инновации в прецизионных фольговых резисторах и фольговых тензодатчиках, которые являются основой продуктов компании для датчиков силы и ее систем взвешивания и контроля.